View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7628_low_6 (Length: 360)
Name: NF7628_low_6
Description: NF7628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7628_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 10 - 342
Target Start/End: Complemental strand, 36161996 - 36161644
Alignment:
| Q |
10 |
gaggttggggcagccagagagaaagaaaagtaatgaatctgtg-----cacacaatgtctgcgccgagagagagagcttcttcagtgatggaaaatgaac |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36161996 |
gaggttggggcagccagagagaaagaaaagtaatgaatctgtggcgtgcacacaatgtctgcgccgagagagag--cttcttcagtgatggaaaatgaac |
36161899 |
T |
|
| Q |
105 |
cgagtaatcttgaaccagcagcat--at----ccggaaaacctgagggaaacgaggtttgtgcagttgatgaagaaagaaggagggagttttatacaata |
198 |
Q |
| |
|
|||||||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36161898 |
cgagtaatcttgaaccagcat-atcgatggcaccggaaaacctgagggaaacgaggtttgtgcagttgatgaagaaagaaggagggagttttatacaata |
36161800 |
T |
|
| Q |
199 |
accggaaattgagagaatgaggt------------gtccaattgcagcaaggatccaaatttcaacacatttagcttgaaacttcttaatatcgaaggat |
286 |
Q |
| |
|
|| |||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36161799 |
actggaaattgagagaatgagttcttgaaggtggggtccaattgcagcaaggatccaaatttcaacacatttagcttgaaacttcttaatatcgaaggat |
36161700 |
T |
|
| Q |
287 |
ttgtatcgatcaaatgtgagagtgagatggaacttttgaatgtcacgggatttgcg |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36161699 |
ttgtatcgatcaaatgtgagagtgagatggaacttttgaatgtcacgggatttgcg |
36161644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 142 - 189
Target Start/End: Complemental strand, 30077173 - 30077126
Alignment:
| Q |
142 |
gagggaaacgaggtttgtgcagttgatgaagaaagaaggagggagttt |
189 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
30077173 |
gagggaaacgaggttgttgcagttgatgaagagggaaggagggagttt |
30077126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 138 - 191
Target Start/End: Complemental strand, 25923155 - 25923102
Alignment:
| Q |
138 |
acctgagggaaacgaggtttgtgcagttgatgaagaaagaaggagggagtttta |
191 |
Q |
| |
|
|||| |||||||||||||| ||||||| ||||| |||||||||| |||||||| |
|
|
| T |
25923155 |
accttagggaaacgaggttgctgcagttcatgaataaagaaggagagagtttta |
25923102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 16 - 48
Target Start/End: Original strand, 25031678 - 25031710
Alignment:
| Q |
16 |
ggggcagccagagagaaagaaaagtaatgaatc |
48 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
25031678 |
ggggcagccagagagaaagacaagtaatgaatc |
25031710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 302 - 342
Target Start/End: Complemental strand, 25922979 - 25922939
Alignment:
| Q |
302 |
gtgagagtgagatggaacttttgaatgtcacgggatttgcg |
342 |
Q |
| |
|
|||| ||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
25922979 |
gtgatagtgagatggaacttctgaatgtcgcgggatttgcg |
25922939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University