View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7630_high_6 (Length: 348)
Name: NF7630_high_6
Description: NF7630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7630_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 118 - 337
Target Start/End: Complemental strand, 45892665 - 45892447
Alignment:
| Q |
118 |
gagactacttgttatggatgtagctccacttgttagagtttattgagttttcnnnnnnnaaaaaacaccttcagaatgcnnnnnnnnttgatcttccata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
45892665 |
gagactacttgttatggatgtagctccacttgttagagtttattgagttttcttttttgaaaaaacaccttcagaatgcaaaaaaa-ttgatcttccata |
45892567 |
T |
 |
| Q |
218 |
ttatatataatacatacaatatgctcagtcatttggattatttattaaacatgagtaggaaaagatccgtatttgtctttcttcattatattcttaccgc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45892566 |
ttatatataatacatacaatatgctcagtcatttggattatttattaaacatgagtaggaaaagatccgtatttgtctttcttcattatattcttaccgc |
45892467 |
T |
 |
| Q |
318 |
aacatggtttttgtaatatt |
337 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45892466 |
aacatggtttttgtaatatt |
45892447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 45892766 - 45892726
Alignment:
| Q |
17 |
actttgtaaatagctagtgaatatatatcatgcatgtatct |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45892766 |
actttgtaaatagctagtgaatatatatcatgcatgtatct |
45892726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University