View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7630_low_17 (Length: 226)
Name: NF7630_low_17
Description: NF7630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7630_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 33161058 - 33161266
Alignment:
| Q |
1 |
ttcaatttcactctaatcaattgctttaaacctaaattaaacatcaaatacagttccatttcactttaatttatcacttcaaaacctaaattagacatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33161058 |
ttcaatttcactctaatcaattgctttaaacctaaattaaacatcaaatacagttccatttcactttaatttatcacttcaaaacctaaattagacatta |
33161157 |
T |
|
| Q |
101 |
aacatagttcaatttcactcatcaattcctctgaaacctaaattagaagctcaaattcaatcgaatagaatcatagaacaaaacttgaacactcactttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33161158 |
aacatagttcaatttcactcatcaattcctctgaaacctaaattagaagctcaaattcaatcgaatagaatcatagaacaaaacttgaacactcactttg |
33161257 |
T |
|
| Q |
201 |
acatggaag |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
33161258 |
acatggaag |
33161266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University