View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7632_high_3 (Length: 323)

Name: NF7632_high_3
Description: NF7632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7632_high_3
NF7632_high_3
[»] chr6 (3 HSPs)
chr6 (186-310)||(8315083-8315212)
chr6 (80-147)||(8320200-8320267)
chr6 (16-56)||(8320265-8320305)
[»] chr8 (1 HSPs)
chr8 (73-185)||(28311801-28311913)


Alignment Details
Target: chr6 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 186 - 310
Target Start/End: Complemental strand, 8315212 - 8315083
Alignment:
186 ttttgaaccacctcctttgcatccaacctttttactagagtttctagttgaatgctaagagtgtttagcatgtttttaatcatt-----tgttgtctcat 280  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||     |||||||||||    
8315212 ttttgaaccacctcctttgcatccaacctttttactagagtttctagttgaatgctaagagtgtttaacatgtttttaatcatttgtaatgttgtctcat 8315113  T
281 gttaatgtgctgtgttctctatcgtttggt 310  Q
    ||||||||| ||||||||||||||||||||    
8315112 gttaatgtgttgtgttctctatcgtttggt 8315083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 80 - 147
Target Start/End: Complemental strand, 8320267 - 8320200
Alignment:
80 ttgtggaggttagctagcgttgttgcttttgtaggagaaatttggatgatctgctcaaccatggttat 147  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
8320267 ttgtggaggttagctagcgttgttgcatttgtaggagaaatttggatgatctgctcaaccatggttat 8320200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 16 - 56
Target Start/End: Complemental strand, 8320305 - 8320265
Alignment:
16 atcatcacttttaggctcagtacccttgattgttgctattg 56  Q
    ||||||||||||||||||||||||||||||| |||||||||    
8320305 atcatcacttttaggctcagtacccttgattattgctattg 8320265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 73 - 185
Target Start/End: Original strand, 28311801 - 28311913
Alignment:
73 gattagcttgtggaggttagctagcgttgttgcttttgtaggagaaatttggatgatctgctcaaccatggttataagtgttggaataaggatttctctg 172  Q
    |||||||||||||||||| |   |||||||| ||||||||||| |||||  ||||||||| ||||||| |||||||||| || ||||| | |||||||||    
28311801 gattagcttgtggaggttggagggcgttgttacttttgtaggaaaaattcagatgatctgttcaaccagggttataagtattagaatacgtatttctctg 28311900  T
173 ctgcctggtaaag 185  Q
    || |||| |||||    
28311901 ctccctgataaag 28311913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University