View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7632_high_4 (Length: 240)
Name: NF7632_high_4
Description: NF7632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7632_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 17 - 141
Target Start/End: Original strand, 23683863 - 23683987
Alignment:
| Q |
17 |
agtgaggacaagaaaagagatttacaaccaagatcaactatgcttttaggaaaggtttatgcatgattctaatgagttctagaagaaaagagacaatatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| | ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23683863 |
agtgaggacaagaaaagagatttacagccaagatcagccatgcttttaagagaggtttatgcatgattctaatgagttctagaagaaaagagacaatatt |
23683962 |
T |
 |
| Q |
117 |
gtcttatttaattatgaaattaagt |
141 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
23683963 |
gtcttatttaattatgaaattaagt |
23683987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 17 - 141
Target Start/End: Complemental strand, 19737481 - 19737357
Alignment:
| Q |
17 |
agtgaggacaagaaaagagatttacaaccaagatcaactatgcttttaggaaaggtttatgcatgattctaatgagttctagaagaaaagagacaatatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| | |||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| | || |
|
|
| T |
19737481 |
agtgaggacaagaaaagagatttacagccaagatcagccatgcttttaggagaggtttatgcatgattttaatgagttctggaagaaaagagacagtgtt |
19737382 |
T |
 |
| Q |
117 |
gtcttatttaattatgaaattaagt |
141 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
19737381 |
gtcttatttaattatgaaattaagt |
19737357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 236
Target Start/End: Original strand, 23684046 - 23684076
Alignment:
| Q |
206 |
ggtatttaatcagaaaaagttgaagctttac |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23684046 |
ggtatttaatcagaaaaagttgaagctttac |
23684076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 19737300 - 19737271
Alignment:
| Q |
205 |
gggtatttaatcagaaaaagttgaagcttt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19737300 |
gggtatttaatcagaaaaagttgaagcttt |
19737271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 96
Target Start/End: Original strand, 21460562 - 21460602
Alignment:
| Q |
56 |
atgcttttaggaaaggtttatgcatgattctaatgagttct |
96 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||| ||||| |
|
|
| T |
21460562 |
atgcttttaggagaggtttatgcatgattctgatgggttct |
21460602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University