View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7632_low_2 (Length: 393)
Name: NF7632_low_2
Description: NF7632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7632_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 19 - 254
Target Start/End: Original strand, 49976357 - 49976587
Alignment:
| Q |
19 |
agaagggaggtaagtgagagagagtgtagcagaagaactgatagagaactttcaaagctctttatcttctacaatcactcaaactatagcctctacaata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49976357 |
agaagggaggtaagtgagagagagtgtagcagaagaactgatagagaactttcaaagctctttatcttctacaatcactcaaactatagcctctacaata |
49976456 |
T |
|
| Q |
119 |
tctttttctttctgtagtctctttctgctggtatcatattacaatcaccatgtaggtcttccgtcccccacttactactacaccttcatagattgatctg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49976457 |
tctttttctttctgtagtctctttctgctggtatcatattacaatcaccatgtaggtcttccgtcccccacttactactacaccttcatagat-----tg |
49976551 |
T |
|
| Q |
219 |
atcatcttctcctcttcaacttctactctatttcct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
49976552 |
atcatcttctcctcttcaacttctactctatttcct |
49976587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 49976630 - 49976718
Alignment:
| Q |
305 |
tttatgactttgttaattattacaggagaccagatggaaatccattagaccttaacaatctgcctgatgacaactctagtagagatcac |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49976630 |
tttatgactttgttaattattacaggagaccagatggaaatccattagaccttaacaatctgcctgatgacaactctagtagagatcac |
49976718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 34 - 100
Target Start/End: Complemental strand, 49954478 - 49954413
Alignment:
| Q |
34 |
gagagagagtgtagcagaagaactgatagagaactttcaaagctctttatcttctacaatcactcaa |
100 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49954478 |
gagagagag-gtggcagaagaactgatagagaactttcaaagctctttatcttctaccatcactcaa |
49954413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University