View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7633_high_8 (Length: 239)
Name: NF7633_high_8
Description: NF7633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7633_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 223
Target Start/End: Complemental strand, 47257743 - 47257535
Alignment:
| Q |
15 |
aaaacaaattaacaaaataaacaaccttatttcaaaaccccgaggatcaaacttgaactgcataatctttgaactttgtttgaaatttacctctctaata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47257743 |
aaaacaaattaacaaaataaacaaccttatttcaaaaccctgaggatcaaacttgaactgcataatctttgaactttgtttgaaatttacctctctaata |
47257644 |
T |
 |
| Q |
115 |
ttttgcccttcttgagtggaaatagtggaggcaaagcactgtttttcatctgtgtacaaattggcacattaatcattggtctaattctaatagtagctga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47257643 |
ttttgcccttcttgagtggaaatagtggaggcaaagcactgtttttcatctgtgtacaaattggcacattaatcattggtctaattctaatagtagctga |
47257544 |
T |
 |
| Q |
215 |
tcttgttct |
223 |
Q |
| |
|
||||||||| |
|
|
| T |
47257543 |
tcttgttct |
47257535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University