View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7633_high_8 (Length: 239)

Name: NF7633_high_8
Description: NF7633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7633_high_8
NF7633_high_8
[»] chr1 (1 HSPs)
chr1 (15-223)||(47257535-47257743)


Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 223
Target Start/End: Complemental strand, 47257743 - 47257535
Alignment:
15 aaaacaaattaacaaaataaacaaccttatttcaaaaccccgaggatcaaacttgaactgcataatctttgaactttgtttgaaatttacctctctaata 114  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47257743 aaaacaaattaacaaaataaacaaccttatttcaaaaccctgaggatcaaacttgaactgcataatctttgaactttgtttgaaatttacctctctaata 47257644  T
115 ttttgcccttcttgagtggaaatagtggaggcaaagcactgtttttcatctgtgtacaaattggcacattaatcattggtctaattctaatagtagctga 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47257643 ttttgcccttcttgagtggaaatagtggaggcaaagcactgtttttcatctgtgtacaaattggcacattaatcattggtctaattctaatagtagctga 47257544  T
215 tcttgttct 223  Q
    |||||||||    
47257543 tcttgttct 47257535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University