View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7634_low_2 (Length: 383)
Name: NF7634_low_2
Description: NF7634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7634_low_2 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 121 - 383
Target Start/End: Original strand, 36261659 - 36261921
Alignment:
| Q |
121 |
aaaaccttattataatatgtaatgaaaaactgtcaacgcaaaaagatgttttggtacatgtttgctgctgacaagactttgataattgagtacaagcaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36261659 |
aaaaccttattataatatgtaatgaaaaactgtcaacgcaaaaagatgttttggtacatgtttgctgctgacaagactttgataattgagtacaagcaaa |
36261758 |
T |
|
| Q |
221 |
tacaaaaggcacaagatgaagaaccttaatttcatctcctatgtaaatcagccaactcaaacagatatatctttgccaaagagattgctaattccctttc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36261759 |
tacaaaaggcacaagatgaagaaccttaatttcatctcctatgtaatgaagccaactcaaacagatatatctttgccaaagagattgctaattccctttc |
36261858 |
T |
|
| Q |
321 |
caggatcactttgtttcacaatagactctcccaccaaaccctgtgaaaaaatgactaaagagt |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
36261859 |
caggatcactttgtttcacaatagactctcccaccaaaacctgtgaaaaaatgacgaaagagt |
36261921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University