View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7636_high_16 (Length: 451)
Name: NF7636_high_16
Description: NF7636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7636_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 404; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 404; E-Value: 0
Query Start/End: Original strand, 14 - 443
Target Start/End: Original strand, 4468418 - 4468849
Alignment:
| Q |
14 |
atcaaatagttcataatttagctccaatttttctactttcaaacatcactt-tgttatgaactggcataggcctcaaaatcttcgttatgtaaggctaaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4468418 |
atcaaatagttcataatttagctccaatttttctactttcaaacatcacttatgttatgaactggcataggcctcaaaatcttcgttatgtaaggctaaa |
4468517 |
T |
|
| Q |
113 |
cacacaggctcaaccatggattctcactatcccgtaacgcctcaatggctagctcagttctagattcttgatcatgtgtaacacccccaacag-tagtaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
4468518 |
cacacaggctcaaccatggattctcactatcccgtaacgcctcaatggctagctcagttctagattcttgatcatgtgtaacacccccaacggctagtaa |
4468617 |
T |
|
| Q |
212 |
tagtcgttggagctgaacactgataaacgtcgtatgtaacgaaccctttgtcagtctctaacaactccttgtcagtgcctataaaatacatgcttctttc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4468618 |
tagtcgttggagctgaacactgataaacgtagtatgtaacgaaccctttgtcaatctctaacaactccttgtcagtgcctataaaatacatgcttctttc |
4468717 |
T |
|
| Q |
312 |
accacaaatgcaaggtacacaatttgtcaatttatatccactttctatctcatactctttgctcaatcattgacttgaacgtcagagtgactgcaggtac |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4468718 |
accacaaatgcaaggtacacaatttgtcaatttatatccactttctatctcatactctttgctcaatcattgacttgaacgtcagagtgactgcaggtac |
4468817 |
T |
|
| Q |
412 |
tgacctaacgtcaatctcgaccaattcatctc |
443 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4468818 |
tgacctaacgtcaatctcgaccaattcatctc |
4468849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University