View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7636_high_47 (Length: 316)
Name: NF7636_high_47
Description: NF7636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7636_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 14 - 304
Target Start/End: Complemental strand, 40675464 - 40675173
Alignment:
| Q |
14 |
cactttcctacgtaaagagaatgattttggaaaacggctataaaaatgagatgaagatgataaagcaaattgttgtaactctctattcatctttattttt |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40675464 |
cactttcttacgtaaagagaatgattttggaaaacggctataaaaatgagatgaagatgatactgcaaattgttgtaactctctattcatctttattttt |
40675365 |
T |
 |
| Q |
114 |
aattacttaattaattgttttctaactacatgtctctaatcaccggaaaatgtgcaatgtcaccttaatgttcatggttgctgcaaaattcatggagacc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40675364 |
aattacttaattaattgttttctaactacatgtctcaaatcaccggaaaatgtgcaatgtcaccttaatgttcatggttgctgcaaaattcatggagacc |
40675265 |
T |
 |
| Q |
214 |
aaagagaaggagagagaaagtaaaaggattccaaaaaatgtgacc-actagcttatggttcaacgttaaattaggaatgagaagctgatatt |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40675264 |
aaagagaaggagagagaaagtaaaaggattccaaaaaatgtgaccaactagcttatggttcaacgttaaattaggaatgagaagctgatatt |
40675173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University