View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7636_high_62 (Length: 253)
Name: NF7636_high_62
Description: NF7636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7636_high_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 54087666 - 54087452
Alignment:
| Q |
18 |
agaacgttatggaagagttaccaagctattttgttagaaatttatttttatctgttattattgatcttccattgatttataaaactaaacgttggttaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54087666 |
agaacgttatggaagagttaccaagctattttgttagaaatttatttttatctgtaattattgatcttccattgatttataaaactaaacgttggttaac |
54087567 |
T |
|
| Q |
118 |
tcatatgttaataacttaatatatgtcccggactatttgtgtttatannnnnnnnngattatgtaacaattgtaacccttttgtaaatggcaaatttcct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
54087566 |
tcatatgttaataacttaatatatgtcccggactatttgtgtttata-----ttttgattatgtaacagttgtaacccttttgtaaatagcaaatttcct |
54087472 |
T |
|
| Q |
218 |
cttcactttctctataagcat |
238 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
54087471 |
cttcactttct-tataagcat |
54087452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 114
Target Start/End: Complemental strand, 22382311 - 22382275
Alignment:
| Q |
78 |
ttgatcttccattgatttataaaactaaacgttggtt |
114 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
22382311 |
ttgatcttccattgatttataaaattaaacattggtt |
22382275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University