View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7636_high_66 (Length: 249)
Name: NF7636_high_66
Description: NF7636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7636_high_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 114 - 225
Target Start/End: Complemental strand, 6627688 - 6627577
Alignment:
| Q |
114 |
caatgacaatgttttacaaataatgaatcattcttgttctaatcataattattgtaatgtaaattattgcttgcattcgccatgcgttggttgccaaccc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6627688 |
caatgacaatgttttacaaataatgaatcattcttgttctaatcataattattgtaatgtaaattattgcttgcattcgccatgcgttggttgccaaccc |
6627589 |
T |
 |
| Q |
214 |
taattttcaatc |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6627588 |
taattttcaatc |
6627577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University