View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7636_high_80 (Length: 213)
Name: NF7636_high_80
Description: NF7636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7636_high_80 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 42427637 - 42427443
Alignment:
| Q |
18 |
tataaaatagtttagccccggaacattatacgacaattgtttcatgtttactttaaaatattctt--------------ggaaattatacgtgtagagtt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
42427637 |
tataaaatagtttagccccggaacattatacgacaattgtttcatgtttactttaaaatatttttcttcttcaatatggggaaattatacgtgtagagtt |
42427538 |
T |
|
| Q |
104 |
cctaaaaattatgactatagtgccttgcaagtcaatatatattgtattcaaatacgatttagacacgttgccctctaaatttgatgcttggatat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42427537 |
cctaaaaattatgactatagtgccttgcaagtcaatatatattctattcaaatacgatttagacacgttgccctctaaatttgatgcttggatat |
42427443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University