View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7636_low_16 (Length: 471)

Name: NF7636_low_16
Description: NF7636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7636_low_16
NF7636_low_16
[»] chr7 (1 HSPs)
chr7 (1-64)||(25608271-25608334)


Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 25608271 - 25608334
Alignment:
1 tcctttttcgacgatgattattattttccnnnnnnnntaatttcaaactaaataaataactaac 64  Q
    |||||||||||||||||||||||||||||        |||||||||||||||||||||||||||    
25608271 tcctttttcgacgatgattattattttccaaaaaaaataatttcaaactaaataaataactaac 25608334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University