View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7636_low_28 (Length: 412)
Name: NF7636_low_28
Description: NF7636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7636_low_28 |
 | |
|
| [»] scaffold1037 (1 HSPs) |
| | |
|
| [»] scaffold1031 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 387; Significance: 0; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 387; E-Value: 0
Query Start/End: Original strand, 1 - 395
Target Start/End: Complemental strand, 15171488 - 15171094
Alignment:
| Q |
1 |
agaaacttttcgatgacaaatacagttttgatggttacaagaaactggaattagggatgaatgcgtttgatataatatcgttgtcgtcgggtttgaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15171488 |
agaaacttttcgatgacaaatacagttttgatggttacaagaaactggaattagggatgaatgcgtttgatataatatcgttgtcgtcgggtttgaattt |
15171389 |
T |
|
| Q |
101 |
gagtggtttgtttgaaacgacgacgttaaggagtgagaagaggtttacttcaagtgaagaagtgggtgtggttgaggagaaggtgaaggagattggagtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15171388 |
gagtggtttgtttgaaacgacgacgttaaggagtgagaagaggtttacttcaagtgaagaagttggtgtggttgaggagaaggtgaaggagattggagtg |
15171289 |
T |
|
| Q |
201 |
agattagggtttcgggttgagattgggaagaatggtgcaattggattggggaaagggaaggttaccatggttgttgaggtgtttaagattgttgatgatt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15171288 |
agattagggtttcgggttgagattgggaagaatggtgcaattggattggggaaagggaaggttactatggttgttgaggtgtttaagattgttgatgatt |
15171189 |
T |
|
| Q |
301 |
tgttgttggttgctcttaaattggagaatggtggattggagtttgaggatgttcattggaatgattggaaaattgggcttcaagatgttgttctt |
395 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15171188 |
tgttgttggttgctcttaaattggagaatggtggattggagtttgaggatgttcattggaatgattggaaaattgggcttcaagatgttgttctt |
15171094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 34016881 - 34016817
Alignment:
| Q |
58 |
tgaatgcgtttgatataatatcgttgtcgtcgggtttgaatttgagtggtttgtttgaaacgacg |
122 |
Q |
| |
|
||||||||||| |||||||||| |||| ||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
34016881 |
tgaatgcgtttcatataatatctatgtcttcgggtttggatttgagtggtttatttgaaacgacg |
34016817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 215 - 262
Target Start/End: Complemental strand, 34016697 - 34016650
Alignment:
| Q |
215 |
ggttgagattgggaagaatggtgcaattggattggggaaagggaaggt |
262 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
34016697 |
ggttgaggttgggaagaatagtgcaattggattggtgaaagggaaggt |
34016650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1037 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold1037
Description:
Target: scaffold1037; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 395
Target Start/End: Complemental strand, 381 - 338
Alignment:
| Q |
352 |
ttcattggaatgattggaaaattgggcttcaagatgttgttctt |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
381 |
ttcattggaatgattggaaaattgggcttcaagatgttgttctt |
338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1031 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold1031
Description:
Target: scaffold1031; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 352 - 395
Target Start/End: Complemental strand, 499 - 456
Alignment:
| Q |
352 |
ttcattggaatgattggaaaattgggcttcaagatgttgttctt |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
499 |
ttcattggaatgattggaaaattgggcttcaagatgttgttctt |
456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University