View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7636_low_59 (Length: 296)
Name: NF7636_low_59
Description: NF7636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7636_low_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 286
Target Start/End: Complemental strand, 2817953 - 2817674
Alignment:
| Q |
19 |
tttataaatcatttccaagatcctaatatttattggtttgaccaacttgtaaaaactatta-tgttctgacaagtta----gtaacggttccctttattt |
113 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
2817953 |
tttataaatcatttccaagatcccaatatttattggtttgaccaacttgtaaaaactattaatgttctgataagttatttagtaacggttccctttattt |
2817854 |
T |
 |
| Q |
114 |
atgcaacgagtttgattgcatctcctttcacttcggtatagtcggataacaacctccatagtactgact--------tctgaggtctgaaaagatagaag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2817853 |
atgcaacgagtttgattgcatctcctttcacttcggtatagtcggataacaacctccatagtactgactttccctactctgaggtctgaaaagatagaag |
2817754 |
T |
 |
| Q |
206 |
gaatatctaacctaannnnnnnatccattaccatcaacacagaatcatcccacaagtctctctatcccttcactacttctt |
286 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2817753 |
gaatatctaacctaa-tttttgatccattaccatcaacacagaatcatcccacaagtctctctatcccttcactacttctt |
2817674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University