View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7636_low_62 (Length: 283)
Name: NF7636_low_62
Description: NF7636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7636_low_62 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 43668693 - 43668428
Alignment:
| Q |
1 |
gtggtgaataacacatagaagaaaaacattttcaaaatagtagagtgtgatctctaaaataaatgatttcatactttagtattccgagcaattttggtag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43668693 |
gtggtgaataacacatagaagaaaaacattttcaaaatagtagagtgtgatctctaaaataaatgatttcatactttagtattccgagcaattttggtag |
43668594 |
T |
|
| Q |
101 |
tattgtgggatgttgatttcgctagttttctctatgtata-ggtacttatactaaaatgttgaagcttgttttataccacggatcacgacaagataggaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43668593 |
tattgtgggatgttgatttcgctagttttctctatgtatagggtacttatactaaaatgttgaagcttgttttataccacggatcacgacaagataggaa |
43668494 |
T |
|
| Q |
200 |
agagttgatgcacaattgatagatagtcaaagaacgttttaaagaaagtgatctaatctactatct |
265 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43668493 |
agagttgatgcacagttgatagatagtcaaagaacgttttaaagaaagtgatctaatctactatct |
43668428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University