View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7636_low_64 (Length: 272)
Name: NF7636_low_64
Description: NF7636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7636_low_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 33697610 - 33697853
Alignment:
| Q |
18 |
tcttttcatatggataagttagaaatggaatcctgaccacatatttagagaaattagaaacacatttaattcactaatattcaaaacgcacatatcactc |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33697610 |
tcttttcatatggataagtcagaaatggaatcctgaccacatatttagagaaattagaaacacatttaattcactaatattcaaaacgcacatatcactc |
33697709 |
T |
|
| Q |
118 |
gaaaatcaagtctgattcatccaagccatcagataaggcgtcttcaatttgtcaagaatatatatatgttatatacttccaactaaccgtcaagaaatgt |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33697710 |
gaaaatcaagtccgattcatccaagccaccagacaaggcgtcttcaatttgtcaagaatatatatatgttatatacttccaactaaccgtcaagaaatgt |
33697809 |
T |
|
| Q |
218 |
tctatacatctactaatctacggtctctaaacattcacatctct |
261 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33697810 |
tctatacatctactaacctacggtctctaaacattcacatctct |
33697853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University