View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7636_low_69 (Length: 259)
Name: NF7636_low_69
Description: NF7636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7636_low_69 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 35194983 - 35195222
Alignment:
| Q |
1 |
attacgggttcaaaccctcatcccaacatatcaaatgttcatgcaacaatttaccatctgagttatactattaagtaatcatatcttcacacatataagt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35194983 |
attacgggttcaaaccctcaccccaacatatcaaatgttcatgcaacaatttaccatctgagttatactactaagtaatcatatcttcacacatataagt |
35195082 |
T |
|
| Q |
101 |
tttgannnnnnnncttatcaccaattattgaattacaatactgattgcagtgccaggatcaatttaatttcatgccaattgtagaaagggtcaaacatct |
200 |
Q |
| |
|
||||| ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35195083 |
tttgattttttttcttatcaccaattattgaaatacagtactgattgcagtgccaggatcaatttaatttcatgccaattgtagaaagggtcaaacatct |
35195182 |
T |
|
| Q |
201 |
ttgtggttggtttctatgaaatgcttatccatccaaattg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35195183 |
ttgtggttggtttctatgaaatgcttatccatccaaattg |
35195222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 39535469 - 39535519
Alignment:
| Q |
19 |
catcccaacatatcaaatgttcatgcaacaatttaccatctgagttatact |
69 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| |||||| |||| |
|
|
| T |
39535469 |
catcccaacatatcaaatattcatgcaacattttaccatttgagttgtact |
39535519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 48757495 - 48757458
Alignment:
| Q |
1 |
attacgggttcaaaccctcatcccaacatatcaaatgt |
38 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||| |
|
|
| T |
48757495 |
attacgggttcaaatccgcatcccaacatatcaaatgt |
48757458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University