View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7636_low_85 (Length: 239)
Name: NF7636_low_85
Description: NF7636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7636_low_85 |
 | |
|
| [»] scaffold0459 (1 HSPs) |
| | |
|
| [»] scaffold0366 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0459 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 2238 - 2460
Alignment:
| Q |
1 |
aacaattacgcaggtgtgacacaccttgcnnnnnnngaaaattgtgaatgccgaagcctgagtacaccattcactacagactagttgcgtatggattcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2238 |
aacaattacgcaggtgtgacacaccttgcaaaaaaagaaaattgtgaatgccgaagcctgagtacaccattcactacagactagttgcgtatggattcaa |
2337 |
T |
|
| Q |
101 |
ggataatttcatttatgtagaagcaaacaaatttattagaacaaaatatccagtctgcaaagttgcagaaagaatagaaccgtcaaactctaacttacga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2338 |
ggataatttcatttatgtagaagcaaacaaatttattagaacaaaatatccagtctgcaaagttgcagaaagaatagaaccgtcaaactctaacttacga |
2437 |
T |
|
| Q |
201 |
aggatgctacaaaaccagcttaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2438 |
aggatgctacaaaaccagcttaa |
2460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 2238 - 2460
Alignment:
| Q |
1 |
aacaattacgcaggtgtgacacaccttgcnnnnnnngaaaattgtgaatgccgaagcctgagtacaccattcactacagactagttgcgtatggattcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2238 |
aacaattacgcaggtgtgacacaccttgcaaaaaaagaaaattgtgaatgccgaagcctgagtacaccattcactacagactagttgcgtatggattcaa |
2337 |
T |
|
| Q |
101 |
ggataatttcatttatgtagaagcaaacaaatttattagaacaaaatatccagtctgcaaagttgcagaaagaatagaaccgtcaaactctaacttacga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2338 |
ggataatttcatttatgtagaagcaaacaaatttattagaacaaaatatccagtctgcaaagttgcagaaagaatagaaccgtcaaactctaacttacga |
2437 |
T |
|
| Q |
201 |
aggatgctacaaaaccagcttaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2438 |
aggatgctacaaaaccagcttaa |
2460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 51 - 223
Target Start/End: Complemental strand, 44372564 - 44372392
Alignment:
| Q |
51 |
ccgaagcctgagtacaccattcactacagactagttgcgtatggattcaaggataatttcatttatgtagaagcaaacaaatttattagaacaaaatatc |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44372564 |
ccgaagcctgagtacaccattcactacagactagttgcgtatggattcaaggataatttcatttatgtagaagcaaacaaatttattagaacaaaatatc |
44372465 |
T |
|
| Q |
151 |
cagtctgcaaagttgcagaaagaatagaaccgtcaaactctaacttacgaaggatgctacaaaaccagcttaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44372464 |
cagtctgcaaagttgcagaaagaatagaaccgtcaaactctaacttacgaaggatgctacaaaaccagcttaa |
44372392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University