View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7636_low_87 (Length: 231)
Name: NF7636_low_87
Description: NF7636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7636_low_87 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 20 - 217
Target Start/End: Complemental strand, 15277738 - 15277541
Alignment:
| Q |
20 |
gttttgtagctcatctatccgtcnnnnnnntgttgtagctcatctaaaacataacttagagcaaaagctccaccagcttaagaaaaaagatggtcaaatg |
119 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15277738 |
gttttgtagctcatctatccgtcaaaaaaatgttgtagctcatctaaaacataacttagagcaaaagctccaccagcttaagaaaaaagatggtcaaatt |
15277639 |
T |
 |
| Q |
120 |
taaaacataacttgcagctcatctttgatataggaatactccgtcgtccaccgttcgcgtagtaactccctttaccggaaaccaaactttcttcatct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15277638 |
taaaacataacttgcagctcatctttgatataggaatactccgtcgtccaccgttcgcgtagtaactccctttaccggaaaccaaactttcttcatct |
15277541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 52 - 94
Target Start/End: Complemental strand, 14720205 - 14720163
Alignment:
| Q |
52 |
ttgtagctcatctaaaacataacttagagcaaaagctccacca |
94 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
14720205 |
ttgtagctcatctaaaacataaattatagcaaaagctccacca |
14720163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University