View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7638_high_28 (Length: 267)
Name: NF7638_high_28
Description: NF7638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7638_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 11 - 246
Target Start/End: Original strand, 56492439 - 56492674
Alignment:
| Q |
11 |
cagagacagatgtaattgtgattgggagtggtattggtggactgagttgtgcagcactgttggcaagatatgaacaagatgttgtcgttttcgaaagcca |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492439 |
cagaaacagatgtaattgtgattgggagtggtattggtggactgagttgtgcagcactgttggcaagatatgaacaagatgttgtcgttttcgaaagcca |
56492538 |
T |
 |
| Q |
111 |
cgaccatgctggaggtgctgctcattcttttgatgtcaaaggctataagtttgattccggtccatcattattctctggtttgcagtcaagaggtccacag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492539 |
cgaccatgctggaggtgctgctcattcttttgatgtcaaaggctataagtttgattccggtccatcattattctctggtttgcagtcaagaggtccacag |
56492638 |
T |
 |
| Q |
211 |
gctaaccctcttgctcaagttcttgatgctttggga |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492639 |
gctaaccctcttgctcaagttcttgatgctttggga |
56492674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University