View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7638_low_10 (Length: 436)
Name: NF7638_low_10
Description: NF7638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7638_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 19 - 421
Target Start/End: Original strand, 19264117 - 19264519
Alignment:
| Q |
19 |
atttggtggcgtaattcctccgttttcgcctcaacttcctctcttatttgttcttacttttctaacttggattggttttccatgtctcgttcatggagct |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19264117 |
atttggtggcgtaattcctccgttctcgcctcaacttcctctcttatttgttcttacttttctaacttggattggttttccatgtctcgttcatggagct |
19264216 |
T |
 |
| Q |
119 |
ccttcaccaccgctagaagtcactctagcataatgttataagctccctcgttgatgtctttcgtgatgttcccattgcgcaaagatggtgccatttcaaa |
218 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19264217 |
ccttcaccatcgctagaagttactctagcataatgttagaagctccctcgttgatgtctttcgtgatgttcccactgcgcaaagatggtgccatttcaaa |
19264316 |
T |
 |
| Q |
219 |
tgggtgatgatgttggttaatggatctaggtcgttggtgggttttaccataccatgcaatgaacaccaacactcttgtttagaaaatgagtctagggttt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19264317 |
tgggtgatgatgttggttaatggatctaggtcgttggtgggttttaccataccatgcaatgaacaccaacactcttgtttagaaaatgagtatagggttt |
19264416 |
T |
 |
| Q |
319 |
ggcccctaagaagggatggttgcatagagttaagtgtgtgtggtcaaatgggatcccttagcttagaagctaaaccttttttatatagtggttgctctag |
418 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19264417 |
ggcccctaagaagggttggttgcatagagttaagtgtgtgtggtcaaatgtgatcccttaacttagaagctaaaccttttttatatagtggttgctctag |
19264516 |
T |
 |
| Q |
419 |
gat |
421 |
Q |
| |
|
||| |
|
|
| T |
19264517 |
gat |
19264519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University