View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7638_low_13 (Length: 416)

Name: NF7638_low_13
Description: NF7638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7638_low_13
NF7638_low_13
[»] chr3 (1 HSPs)
chr3 (271-309)||(8521930-8521968)


Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 271 - 309
Target Start/End: Complemental strand, 8521968 - 8521930
Alignment:
271 aatagacatggtaagtgtgatatttacatgattagttag 309  Q
    |||||||||| ||||||||||||||||||||||||||||    
8521968 aatagacatgataagtgtgatatttacatgattagttag 8521930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University