View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7638_low_21 (Length: 312)
Name: NF7638_low_21
Description: NF7638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7638_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 9278730 - 9279020
Alignment:
| Q |
1 |
accattgtcccttttccatttaatttacaataatatatgctccattataccaattctgactttagaaagagcaattctctgtaataaatcatatggttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9278730 |
accattgtcccttttccatttaatttacaataatatatgctccattataccaattctgactttagaaagagcaattctctgtaataaatcatatggttta |
9278829 |
T |
 |
| Q |
101 |
tacaaccactatctatgactatatgccacctttcagtggagctattggcagtaaaacatgttacagcaggcaattgtggttagtccccgacaaccttaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9278830 |
tacaaccactatctatgactatatgccacctttcagtggagctattggcagtaaaacatgctacagcaggcaattgtggttagtccccgacaaccttaac |
9278929 |
T |
 |
| Q |
201 |
ttctccatgcgtcgtaattgaccacgcttatgacaccaagcatttggccttcaccatcnnnnnnnggtgtgattaattttcttgccatgag |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||| |
|
|
| T |
9278930 |
ttctccatgcgtcgtaattgaccacgcttatgacaccaagcatttggccttcgccatctttttttggtgtgattaatttccttgccatgag |
9279020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University