View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7638_low_31 (Length: 262)
Name: NF7638_low_31
Description: NF7638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7638_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 56492467 - 56492219
Alignment:
| Q |
1 |
actcccaatcacaattacatctgtttctgtttcatctactttgttgctgctgtttcgcaccacaaccccacctttcctaatcctcccattactatgacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492467 |
actcccaatcacaattacatctgtttctgtttcatctactttgttgctgctgtttcgcaccacaaccccacctttcctaatcctcccattactatgacta |
56492368 |
T |
|
| Q |
101 |
tgatgatcatcatcatcaattcttgaacagtatcttctcactctcattacattacaaggaaacacaccaacacttacacccctcatcgcattcatggcat |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492367 |
tgatgatgatcatcatcaattcttgaacagtattttctcactctcattacattacaaggaaacacaccaacacttacacccctcatcgcattcatggcat |
56492268 |
T |
|
| Q |
201 |
ggcatagcatggaaaccaaacaccaaatcaaatattatgttgttgtttc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492267 |
ggcatagcatggaaaccaaacaccaaatcaaatattatgttgttgtttc |
56492219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University