View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7638_low_42 (Length: 236)
Name: NF7638_low_42
Description: NF7638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7638_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 219
Target Start/End: Complemental strand, 36428776 - 36428568
Alignment:
| Q |
11 |
cgaagaatatatttgttcaagtgatggtttcactacaccaaaaggtaaaagattcaaaataccagaaatcattgattgtccaccagctccaaagaggaaa |
110 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36428776 |
cgaagaaaatatttgttcgagtgatggtttcactacaccaaaaggtaaaagattcaaaataccagaaatcattgattgtccaccagctccaaagaggaaa |
36428677 |
T |
 |
| Q |
111 |
agaacatggaaatgcccaccatttagaacatcaaaaagtttttcttcaccagaaatggagttgttcttgactacgattagaaagtttacaagttgaagtt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
36428676 |
agaacatggaaatgcccaccatttagaacatcaaaaagtttttcttcaccagaaatcgagttgttcttaactacgattagaaagtttgcaagttgaagtt |
36428577 |
T |
 |
| Q |
211 |
gacggttgt |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
36428576 |
gacggttgt |
36428568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 19 - 74
Target Start/End: Complemental strand, 36308446 - 36308391
Alignment:
| Q |
19 |
atatttgttcaagtgatggtttcactacaccaaaaggtaaaagattcaaaatacca |
74 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
36308446 |
atatttgttcaagtgatggcttcattacaccaaagggtagaagattcaaaatacca |
36308391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University