View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7638_low_46 (Length: 201)
Name: NF7638_low_46
Description: NF7638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7638_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 52 - 178
Target Start/End: Original strand, 34742289 - 34742408
Alignment:
| Q |
52 |
aatggtatccgatgtaaaaccagaataacaaaattttgtaatgcgcgaagcataaaagttgatttcaacatgggactcaggagagctaagtgtgtacttt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34742289 |
aatggtatccgatgtaaaaccagaataacaaaattttgtaatgcgcgaaac-------ttgatttcaacatgagactcaggagagctaagtgtgtacttt |
34742381 |
T |
 |
| Q |
152 |
attgaaaccacttaaagtagaggcact |
178 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34742382 |
attgaaaccacttaaagtagaggcact |
34742408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 16 - 118
Target Start/End: Original strand, 34751423 - 34751525
Alignment:
| Q |
16 |
aatatcagcaaacgctaaactgtgtgcatctaacataatggtatccgatgtaaaaccagaataacaaaattttgtaatgcgcgaagcataaaagttgatt |
115 |
Q |
| |
|
|||||||||||| |||| ||| ||||| ||||||| ||| ||||| || || ||||||||||||| ||||||| || ||||| ||||||||| || ||| |
|
|
| T |
34751423 |
aatatcagcaaatgctacactatgtgcctctaacaaaattgtatctgacatataaccagaataacagaattttgcaaggcgcgtagcataaaacttaatt |
34751522 |
T |
 |
| Q |
116 |
tca |
118 |
Q |
| |
|
||| |
|
|
| T |
34751523 |
tca |
34751525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 70 - 123
Target Start/End: Original strand, 34746867 - 34746920
Alignment:
| Q |
70 |
accagaataacaaaattttgtaatgcgcgaagcataaaagttgatttcaacatg |
123 |
Q |
| |
|
|||| ||||||||||| ||| |||||||||||||||||| || |||||| |||| |
|
|
| T |
34746867 |
accataataacaaaatgttgcaatgcgcgaagcataaaacttaatttcagcatg |
34746920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University