View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7639_high_11 (Length: 265)
Name: NF7639_high_11
Description: NF7639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7639_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 8 - 257
Target Start/End: Complemental strand, 4242385 - 4242136
Alignment:
| Q |
8 |
atgaggaccaagaatcattgcgttgaatatttcaaattgactagtgttgtggcaaaaataacgaccatgcataagtatgatgcacaaaaagatacatgtg |
107 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4242385 |
atgaggaccaagaatcattgtgttgaatatctcaaattgactagtgatgtggcaaaaataacgaccatgcataagtatgatgcacaaaaagatacatgtg |
4242286 |
T |
 |
| Q |
108 |
tgctgagaaagtaaaaagcacacagattatgaatggctaacattacataaaacaggttttggaattatatcaacaattcatttccacattttcttttgtg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4242285 |
tgctgagaaagtaaaaagcacacagattatgaatggctaacattacataaaacaggttttggaattatatcaacaattcatttccacattttcttttgtg |
4242186 |
T |
 |
| Q |
208 |
gtttgtgcgttaaatgaatgtttacgtatcaatggtcatgaatctctgct |
257 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
4242185 |
gtttgtgcgttaaatgaatgtttacatatcaatgctcatgaatctctgct |
4242136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University