View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7639_high_13 (Length: 242)
Name: NF7639_high_13
Description: NF7639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7639_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 39101611 - 39101401
Alignment:
| Q |
17 |
aaactatttcattacaatataagaagataaaggaacaaagggatttgattatttaagaataattctttgatannnnnnnnaaaatattgctctctttgta |
116 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| ||| |
|
|
| T |
39101611 |
aaactatttcattacaaca--agaagataaaggaacaaagggatttgattatttaagaataattctttgatattttttttaaaatattgctccctt-gta |
39101515 |
T |
|
| Q |
117 |
tctctttggtattttacatagagtaaatggacattttaatcattgaaattatggtcaatttatctctcaaatttataaaacaacaatttaatctttgttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39101514 |
tctctttggtattttacatagagtaaatggacattttaatcattgaaattatggtcaatttatctctcaaatttataaaacaacaatttaatttttgttt |
39101415 |
T |
|
| Q |
217 |
cggacttgcccaac |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39101414 |
cggacttgcccaac |
39101401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University