View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7639_low_16 (Length: 224)
Name: NF7639_low_16
Description: NF7639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7639_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 3 - 205
Target Start/End: Complemental strand, 4573566 - 4573364
Alignment:
| Q |
3 |
ttcattgttgtttggcaaaagagaaaacaaaacaatgttgcatatcagacaaagatcatatgaaccgcatgttttttgttgcacaatatggatcatgcaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4573566 |
ttcattgttgtttggcaaaagagaaaacaaaacaatgttacatatcagacaaagatcatatgaaccgcatgttttttgttgcacaatatggatcatgcaa |
4573467 |
T |
 |
| Q |
103 |
atcctgtctaccacttctaaaagtaaaagttagaaacaaaataaagcaatggtagctatcccatcatcaattcaatttcttgacgtatacaaaaaggtta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4573466 |
atcctgtctaccacttctaaaagtaaaaggtagaaacaaaataaagcaatggtagctatcccatcatcaattcaatttcttgacgtatacaaaaaggtta |
4573367 |
T |
 |
| Q |
203 |
agt |
205 |
Q |
| |
|
||| |
|
|
| T |
4573366 |
agt |
4573364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University