View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7642_high_5 (Length: 321)
Name: NF7642_high_5
Description: NF7642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7642_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 34 - 221
Target Start/End: Original strand, 29996797 - 29996984
Alignment:
| Q |
34 |
cttaatgtaggtggttatgtataagctatttatttaacaagataaaataaggtataagctataaggtgttttgataagctagaaggaagataaagtgaaa |
133 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29996797 |
cttattgtaggtggttatgtataagctatttatttaacaagataaaataaggtataagctataaggtgttttgataagctagaaggaagataaagtgaaa |
29996896 |
T |
|
| Q |
134 |
gaagtgaataacctcgacttgagtccaatctgaagaagaaccccaccatgcatcttgtgattgtctagcagaagtagtaactaatctg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29996897 |
gaagtgaataacctcgacttgagtccaatctgaagaagaaccccaccatgcatcttgtgattgactagcagaagtagtaactaatctg |
29996984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University