View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7642_low_6 (Length: 321)

Name: NF7642_low_6
Description: NF7642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7642_low_6
NF7642_low_6
[»] chr8 (1 HSPs)
chr8 (34-221)||(29996797-29996984)


Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 34 - 221
Target Start/End: Original strand, 29996797 - 29996984
Alignment:
34 cttaatgtaggtggttatgtataagctatttatttaacaagataaaataaggtataagctataaggtgttttgataagctagaaggaagataaagtgaaa 133  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29996797 cttattgtaggtggttatgtataagctatttatttaacaagataaaataaggtataagctataaggtgttttgataagctagaaggaagataaagtgaaa 29996896  T
134 gaagtgaataacctcgacttgagtccaatctgaagaagaaccccaccatgcatcttgtgattgtctagcagaagtagtaactaatctg 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
29996897 gaagtgaataacctcgacttgagtccaatctgaagaagaaccccaccatgcatcttgtgattgactagcagaagtagtaactaatctg 29996984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University