View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7644_low_13 (Length: 391)
Name: NF7644_low_13
Description: NF7644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7644_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 10 - 374
Target Start/End: Original strand, 43540004 - 43540368
Alignment:
| Q |
10 |
aaaatacaaacaaaggtgcccatgaatacgtcattatatcaaatggatgttgaccgacaaatatgcattgtatcaaataccagaacttacctcctctact |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43540004 |
aaaatacaaacaaaggtgcccatgaatatgtcattatatcaaatggatgttgactgacaaatatgcatactatcaaataccagaacttacctcctctact |
43540103 |
T |
 |
| Q |
110 |
ccatctgtgtctgtaatgtctaaatatcctttgataagggagttgaaaactacaggatttggatgcactccaagctccttcattttgtatagaaatctca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540104 |
ccatctgtgtctgtaatgtctaaatatcctttgataagggagttgaaaactacaggatttggatgcactccaagctccttcattttgtatagaaatctca |
43540203 |
T |
 |
| Q |
210 |
aggcttctgtcatgttaccttccttacaataaccgcgtattatgataccgcaggttcgttcattaggcttcactttgttattatactgctgcattttcaa |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540204 |
aggcttctgtcatgttaccttccttacaataaccgcgtattatgataccgcaggttcgttcattaggcttcactttgttattatactgctgcattttcaa |
43540303 |
T |
 |
| Q |
310 |
tatcaacctttccgcattatctgtctcaccattctgagcaaacgccctcgccagtgtgttgtatg |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540304 |
tatcaacctttccgcattatctgtctcaccattctgagcaaacgccctcgccagtgtgttgtatg |
43540368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University