View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7644_low_22 (Length: 247)
Name: NF7644_low_22
Description: NF7644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7644_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 22 - 238
Target Start/End: Original strand, 14419568 - 14419784
Alignment:
| Q |
22 |
aatgggggagggggagggctcttgattccgttaacaatttgtggagtccaaagtattgttaccccactttagagaatctttgttttgttttgaggagaat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14419568 |
aatgggggagggggagggctcttgattccgttaacaatttgtggagtccaaagtattgttaccccactttagagaatctttgttttgttttgaggagaat |
14419667 |
T |
 |
| Q |
122 |
aacttattctagaacaaagttggagagagttataagttctaataattaactcatgcaaaggaattgcatgtaaagtaaattagggccattaattatattg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14419668 |
aacttattctagaacaaagttggagagagttataagttctaataattaactcatgcaaacaaattgcatgtaaagtaaattagggccattaattatattg |
14419767 |
T |
 |
| Q |
222 |
attagctggagaataat |
238 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
14419768 |
attagctagagaataat |
14419784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University