View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7644_low_25 (Length: 241)
Name: NF7644_low_25
Description: NF7644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7644_low_25 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 63 - 241
Target Start/End: Complemental strand, 45230987 - 45230809
Alignment:
| Q |
63 |
aatttgtgtgacaaacttactgaccaggttctcaacaatccagagagtacaccgattcacaccttcttttgcaattatgatttaagcgatatgccagctg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45230987 |
aatttgtgtgacaaacttactgaccaggttctcaacaatccagagagtacaccgattcacaccttcttttgcaattatgatttaagcgatatgccagccg |
45230888 |
T |
 |
| Q |
163 |
gtaccaaggtagggttgaatgaaatattgcattcaatattttgtcacgtttggtcttttctagaagttgaatttctgaa |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45230887 |
gtaccaaggtagggttgaatgaaatattgcattcaatattttgtcacgtttggtcttttctagaagttgaatttctgaa |
45230809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University