View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7644_low_3 (Length: 481)
Name: NF7644_low_3
Description: NF7644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7644_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 385; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 385; E-Value: 0
Query Start/End: Original strand, 1 - 462
Target Start/End: Complemental strand, 26620954 - 26620487
Alignment:
| Q |
1 |
ggacctggtggtggaggcattgctgaagaagggattgcgttgttcgctatcgttggagaagcttcagcgttgttctcgttttggtcaaccagttagagga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26620954 |
ggacctggtggtggaggcattgctgaagaagggattgcgttgttcgctatcgttggaaaagctttgacgttgttctcgttttggtcaaccagttagagga |
26620855 |
T |
|
| Q |
101 |
tcagaattgaacgatcttggagagtttgaatcacagatcgaacctccgctgcagtggaggatttacttcggtgtttctcttgcgatttccggtcataatt |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| ||| |
|
|
| T |
26620854 |
tcagaatcgaacgatcttggagagtttgaatcacagatcgaacctccgctgcagtggaggatttacttcggtgtttctcttgcgaattccagtcatgatt |
26620755 |
T |
|
| Q |
201 |
tcctgtgcagagactaaatgtaaaccgttgtggtagagtaacttgtaaccgaaaacggttacgtcagagaaatgcgtaatcaaaaaccg------ttaag |
294 |
Q |
| |
|
|| |||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26620754 |
tcttgtgcagagactaactgtaaatcgttgtggtagagtaacttgtaaccgaaaacggttacgtcagagaaatgcgtaatcaaaaaccgttaacgttaag |
26620655 |
T |
|
| Q |
295 |
gctcaaaatcatttgagccaacgggaatcagtgaacaatcccctctttctagcaccaaaatatcagtgcggtgaagaacgaagatgtgaagtagtggttc |
394 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26620654 |
gctcagaatcatttgagccaacgggaaccagtgaacaatcccctctttctagcaccaaaatatcagtgcggtgaagaacgaagatgtgaagtggtggttc |
26620555 |
T |
|
| Q |
395 |
gcgatgttctggtgtgacagaggttgagcttccacgatggaggagaaaggtgcatgcaggcacattag |
462 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26620554 |
gtgatgttctggtgtgacagaggttgagcttccacgatggaggagaaaggtgcatgcaggcacattag |
26620487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University