View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7645_high_20 (Length: 220)
Name: NF7645_high_20
Description: NF7645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7645_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 15 - 72
Target Start/End: Complemental strand, 36503677 - 36503620
Alignment:
| Q |
15 |
atgaatgagaggctatggttaaaatatctacgaattaggtttagccacgtaaccaaca |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36503677 |
atgaatgagaggctatggttaaaatatctacgaattaggtttagccacgtaaccaaca |
36503620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 167 - 206
Target Start/End: Complemental strand, 36503510 - 36503471
Alignment:
| Q |
167 |
cacaacacagttgttgtgtttcagtttgagttgcagaaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36503510 |
cacaacacagttgttgtgtttcagtttgagttgcagaaag |
36503471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University