View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7645_high_9 (Length: 285)
Name: NF7645_high_9
Description: NF7645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7645_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 41864616 - 41864351
Alignment:
| Q |
1 |
cccttcgtatgaatgttaacctttcatatctgtgtgctttctctttgcatcggtttgttttgttttctcaagaattttctccttacatgttttacattag |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41864616 |
cccttcgtatgaatgttaactcttcatatctgtgtgctttctgtttgtatcggtttgttttgttttctcaagaattttctccttacatgttttacattag |
41864517 |
T |
 |
| Q |
101 |
tttattgtagcttttgtgataattcttcttcccctttgatgcgactttcaagtcaattattaactcgcttagatatatcagcttgctcttcaagcaattt |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
41864516 |
ttcattgtagcttttgtgataattcttcttcccctttgatgcgactttcaagtcaattattaactcacttagatatatcagcttgctcttcaagca--gt |
41864419 |
T |
 |
| Q |
201 |
ttaacatttattggtttgatgattgatgtaaccattgataaaactcatccaaaattattaaatatatt |
268 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41864418 |
ttaacatttattgggttgatgattgatgtaactattgataaaactcatccaaaattattaaatatatt |
41864351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University