View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7645_low_10 (Length: 349)
Name: NF7645_low_10
Description: NF7645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7645_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 186 - 345
Target Start/End: Complemental strand, 26043504 - 26043347
Alignment:
| Q |
186 |
gttaaattaaccaatagtgagtaatagaacgctcattataacataaagtgaaacagctgcatcatgttcctcaccactctctttgttgctcatgctctca |
285 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26043504 |
gttaaattaactaatagtgagtaatagaacactcattataacataaagtgaaacagctgcatcatgttcctcaccactctc-ttgttgctcatgctctca |
26043406 |
T |
 |
| Q |
286 |
catcacatgacaatgttccttcattctcgactctctttgctgcttgtgttcatctcactc |
345 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
26043405 |
catcacatgccaatgttccttcattctcgactctc-ttgctgcttgtgttcctctcactc |
26043347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University