View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7645_low_12 (Length: 295)
Name: NF7645_low_12
Description: NF7645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7645_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 36942713 - 36942447
Alignment:
| Q |
1 |
atgctgtctgttgctaatgttacatggttggctgatatcaaacaaggcagactcaatgaggcttggatcaattacaatgctagttcattaaatctaagtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36942713 |
atgctgtctgttgctaatgttacatggttggctgatatcaaacaaggtagactcaatgaggcttggatcaattacaatgctagttcattaaatctaagtg |
36942614 |
T |
 |
| Q |
101 |
ttttattcactggttttaataacgtaacttctagcattgtgaatcaacatttatcttccatagttgatcttagactttatctgccagaatttgttactat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36942613 |
ttttattcactggttttaataacgtaacttctagcattgtgaatcaacatttatcttccatagttgatcttagactttatctgccagaatttgttactat |
36942514 |
T |
 |
| Q |
201 |
tggcttatcagctgccactggaaatcgcacatctttaaacactatctcttcatgggtttttagctca |
267 |
Q |
| |
|
|||||| ||||||||||||||||||||||| || || ||| |||||||||||||| |||||||||| |
|
|
| T |
36942513 |
tggcttctcagctgccactggaaatcgcactgctgtacacagtatctcttcatgggattttagctca |
36942447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University