View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7645_low_29 (Length: 207)
Name: NF7645_low_29
Description: NF7645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7645_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 49; Significance: 3e-19; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 142 - 194
Target Start/End: Complemental strand, 17741422 - 17741370
Alignment:
| Q |
142 |
ttccagatcttattcttctaccgtcgccatcgccgccgctgcatccaccacca |
194 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17741422 |
ttccagatcttattcttctaccgccgccatcgccgccgctgcatccaccacca |
17741370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 142 - 194
Target Start/End: Complemental strand, 19042742 - 19042690
Alignment:
| Q |
142 |
ttccagatcttattcttctaccgtcgccatcgccgccgctgcatccaccacca |
194 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19042742 |
ttccagatcttattcttctaccgccgccatcgccgccgctgcatccaccacca |
19042690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 114 - 145
Target Start/End: Complemental strand, 5690344 - 5690313
Alignment:
| Q |
114 |
agaagcttttcgaaaacattagattagattcc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5690344 |
agaagcttttcgaaaacattagattagattcc |
5690313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 114 - 145
Target Start/End: Complemental strand, 17741526 - 17741495
Alignment:
| Q |
114 |
agaagcttttcgaaaacattagattagattcc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17741526 |
agaagcttttcgaaaacattagattagattcc |
17741495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 114 - 145
Target Start/End: Complemental strand, 19042846 - 19042815
Alignment:
| Q |
114 |
agaagcttttcgaaaacattagattagattcc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19042846 |
agaagcttttcgaaaacattagattagattcc |
19042815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University