View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7648_high_7 (Length: 499)
Name: NF7648_high_7
Description: NF7648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7648_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 210 - 483
Target Start/End: Original strand, 41364029 - 41364286
Alignment:
| Q |
210 |
aatatattagctcttttaacacactggtatatatattacatggtcggcacaaatatttgacgacccagtccacttttaaaatctgacgcgtgtcgcttcc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41364029 |
aatatattagctcttttaacacactggtatatatattacatggtcggcacaaatatttgacgacccagtccacttttaaaatctgacgtgtgtcgcttcc |
41364128 |
T |
|
| Q |
310 |
tcgtgagctgattgtccctcgctgctgcccttcacttggctccatcccttaacatgttctattggaatgaaagtttggtcatagtataggaggagagtac |
409 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41364129 |
tcgtgagctga-tgtccctcgctgctgcccttcacttggc--------------tgttctattggaatgaaagtttggtcatagtataggaggagagtac |
41364213 |
T |
|
| Q |
410 |
aacactgcgaggggtcgtatgtttttacacttttcaatttcaatcaattattagttcgtgctattctttgattt |
483 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41364214 |
aacactgcgaggggtcg-atgtttttacacttttcaatttcaatcaattattagttcgtgctattctttgattt |
41364286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University