View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7648_low_12 (Length: 476)
Name: NF7648_low_12
Description: NF7648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7648_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 6e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 17559640 - 17559492
Alignment:
| Q |
1 |
atatttcaattcatcattttttatctgtgtttatactttaagtcaattatggtttaactgcacagnnnnnnnnnnnnnagaaatcaaccagtgattaaag |
100 |
Q |
| |
|
|||||||||||| ||||||| ||||| ||||||||||||||||||| ||| |||||||||| || ||||||||| |||||||||||| |
|
|
| T |
17559640 |
atatttcaattctgcattttt-atctgcgtttatactttaagtcaatgatgttttaactgcatagtttttcatgatttagaaatcaatcagtgattaaag |
17559542 |
T |
|
| Q |
101 |
ccacacatcttctacaataactgtctagccagctacctgaattgatgaca |
150 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17559541 |
ccacacatctactacaataactgtctagccagctacctgaattgatgaca |
17559492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 417 - 464
Target Start/End: Complemental strand, 15384465 - 15384418
Alignment:
| Q |
417 |
aatggattgttgtgtttttattttcaaataatatcaatttattgttac |
464 |
Q |
| |
|
||||| ||| |||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
15384465 |
aatggtttgatgtgtttttattttcaaagaatagcaatttattgttac |
15384418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 423 - 463
Target Start/End: Original strand, 11072737 - 11072777
Alignment:
| Q |
423 |
ttgttgtgtttttattttcaaataatatcaatttattgtta |
463 |
Q |
| |
|
|||||||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
11072737 |
ttgttgtgtttttattttcatagaataacaatttattgtta |
11072777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University