View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7648_low_17 (Length: 338)
Name: NF7648_low_17
Description: NF7648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7648_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 38243997 - 38243666
Alignment:
| Q |
1 |
attactacgccaccgccgcagataccgcctttcgatcaccaacctcatccgtattatggaccatccgccgatgaagttttcgccaagcgtaaacagttcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38243997 |
attactacgccaccgccgcagataccgccgttcgatcaccaacctcatccgtattatggaccatccgccgatgaagttttctccaagcgtaaacagttcc |
38243898 |
T |
|
| Q |
101 |
ttggtccttccttgttccatttctatcaaaaacccgtcagttcctatcatcaaactcatttctcttctttaatttcatttattgtttgttac-nnnnnnn |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243897 |
ttggtccttccttgttccatttctatcaaaaacccgtcagttcctatcatcaaactcatttctcttctttaatttcatttattgtttgttactttttttt |
38243798 |
T |
|
| Q |
200 |
natagaagaagaaattgatgatgaatgatgtttgtatagttgaatattgtggaggggaagatgcaatatctgtatgatgaagctggaagacgttaccttg |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243797 |
tatagaagaagaaattgatgatgaatgatgtttttatagttgaatattgtggaggggaagatgcaatatctgtatgatgaagctggaagacgttaccttg |
38243698 |
T |
|
| Q |
300 |
atgcttttgctgggattgtcacaggttctgct |
331 |
Q |
| |
|
||||||||||||||||||| || | ||||||| |
|
|
| T |
38243697 |
atgcttttgctgggattgttactgtttctgct |
38243666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University