View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7648_low_27 (Length: 211)
Name: NF7648_low_27
Description: NF7648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7648_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 12 - 193
Target Start/End: Original strand, 11051067 - 11051247
Alignment:
| Q |
12 |
ttttttattccaagcactttagaaaataatagtaggtgttagcagtgacgaagttagaaaataaggtttgcggggaccaaatttaagagtataactcata |
111 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11051067 |
ttttttattccaagcactttagaaa-taatagtaggtgttagcagggacgaagtaagaagataaggtttgtggggaccaaatttaagagtataactcata |
11051165 |
T |
 |
| Q |
112 |
aagaaaaggaataattttcaaatgtataacaaatagaagaaattccgagcaccattgagacaaatctgcaaaatgtttaaaa |
193 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11051166 |
aagaaaaagaataattttcaaatgtataacaaatagaagaaattacgagcaccattgagacaaatccgcaaaatgtttaaaa |
11051247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University