View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7650_low_12 (Length: 295)
Name: NF7650_low_12
Description: NF7650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7650_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 15 - 273
Target Start/End: Complemental strand, 22861122 - 22860863
Alignment:
| Q |
15 |
aacctgtgtgccatttctcatagcgaacatggagcgagcaaagattctccaactccatgaaatagatcgagttaggatcgataaagctaaaacctacatc |
114 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22861122 |
aacctatgtgccatttctcataacgaacatggagagagcaaagattcccaaactccatgaaatagatcgagttaggatcgataaagctaaaacttacatc |
22861023 |
T |
 |
| Q |
115 |
cctttcttatatgaattccctcaccatctcacccttgctattagataaggaactggaacaacattcgctcaaactttatggg-attctaaggttaaaaga |
213 |
Q |
| |
|
||||||| ||| ||||||||||||| |||||||||| | ||||||||||||| |||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
22861022 |
cctttctgatacgaattccctcaccctctcacccttcttcatagataaggaactagaacaacattcgcttaaactttatgggttttctaaggttaaaaga |
22860923 |
T |
 |
| Q |
214 |
aaggggaaaggaaatacccttagcttctcttggaaaattcaaaa-tttgaagtcattgatg |
273 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
22860922 |
aaggggaaaggaaatacctttagcttctc-tggaaaattcaaaagtttgaagtcattgatg |
22860863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University