View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7650_low_13 (Length: 293)
Name: NF7650_low_13
Description: NF7650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7650_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 16634672 - 16634940
Alignment:
| Q |
1 |
caacttggtgcactaaaatttccgcatacgcgatatgttttttgccactatatgatgttttcaaaacttgaacttaatatgtgacctttcaatcgcataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||| ||||||||| |||||||||||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
16634672 |
caacttggtgcactaaaatttccgcattcgcaatatgtttttttacactatatgttgttttcaaaacttgaacctaaaccgtgacctttcaatcacataa |
16634771 |
T |
|
| Q |
101 |
aaacaatttcacgttgcgtcgagacttactttcttgtaaaaaagaaaacattactggtagataaatattattccactcgatcgatactggc-atgagttt |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
16634772 |
caacaatttcactttgcgtcgagacttactttcttgtaaaaaagaaaacattactggtagataaatattattccac----tcgatactggcaatgagttt |
16634867 |
T |
|
| Q |
200 |
ttgttggtcttttaattttcatccacgatcttgtctttgacggtattcatccacaaattttcaaacaaggcac |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
16634868 |
ttgttggtcttttaattttcatccacgatcttgtctttgacagtattcatccacaaattttcaaacaatgcac |
16634940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University