View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7652_low_4 (Length: 270)
Name: NF7652_low_4
Description: NF7652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7652_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 7 - 254
Target Start/End: Original strand, 7146369 - 7146616
Alignment:
| Q |
7 |
tttggtgttttcctcttttaaggaacaaatgtctcaatatttagccacaagaaaggtctcattgggaatgggaatgtacgtgtaattagcaccggcctcc |
106 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7146369 |
tttggcgttttactcttttaaggaacaaatgtctcaatatttagccacaagaaaggtctcattgggaatgggaatgtacgtgtaattagcaccggcctcc |
7146468 |
T |
 |
| Q |
107 |
acactccagtgctgcgtttgagagcaaattttgtactaactttctctatttagctttctgggatttgtcttctgattagtttacagatattctttttctc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7146469 |
acactccagtgctgcgtttgagagcaaattttgtactaactttctctatttagctttctgggagttgtcttctgattagtttacagatattctttttctc |
7146568 |
T |
 |
| Q |
207 |
ctaatttggagtataannnnnnnaatataacgcagagaagtactttat |
254 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7146569 |
ctaatttggagtataatttttttaatataacgcagagaagtactttat |
7146616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University