View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7653_high_4 (Length: 301)
Name: NF7653_high_4
Description: NF7653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7653_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 13 - 282
Target Start/End: Original strand, 3576082 - 3576351
Alignment:
| Q |
13 |
aatatggccagcaacaaagtatgcaaatgctttatggtggtagcaatgatttacaagcagtagtggagcaatcaaatgaatggaaagcactagacaaatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3576082 |
aatatggccagcaacaaagtatgcaaatgctttatggtggtagcaatgatttacaagcagtagtggagcaatcaaatgaatggaaagcactagacaaatt |
3576181 |
T |
 |
| Q |
113 |
tgttgcttctcgtctaagtcaagatcaagatcatgcttctaagggaactagtagttattgtaatgtggctcaacaaattgctttgctatcaaatgatgaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3576182 |
tgttgcttctcgtctaagtcaagatcaagatcatgcttctaagggaactagtagttattgtaatgtggctcaacaaattgctttgctatcaaatgatgaa |
3576281 |
T |
 |
| Q |
213 |
tccaaaaaatcagaaactggtggccaggaacatgtgacttcaatctccaactcaaattgtcagattgaca |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3576282 |
tccaaaaaatcagaaactggtggccaggaacatgtgacttcaatctccaactcaaattgtcagattgaca |
3576351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University